Recombinant:Article Title: Ex vivo model of functioning human lymph node reveals role for innate lymphocytes and stroma in response to vaccine adjuvant.
Article Snippet: .. Human LN samples were collected over a 3-year period, with the aim of generating at least five donors per group to ensure REAGENT or RESOURCE SOURCE IDENTIFIER Biological samples Healthy human lymph nodes Cholecystectomy REC 21/YH/0206 Chemicals, peptides, and recombinant proteins LMQ Vaccine Formulation Initiative https://doi.org/10.3389/fimmu.2022.976968 1,1’ – Dioctadecyl-3,3,3′3′-Tetramethylindodicarbocyanine Perchlorate (DiD’/DiIC18(5)) oil ThermoFisher Scientific Cat#:D307 TLR4 inhibitor, TAK242 Merck Cat#: 614316 CP-456773 sodium salt (MCC950) Sigma Aldrich Cat#: PZ0280 Critical commercial assays LEGENDplex Human Inflammation Panel 1 BioLegend Cat#:740809 Human IL-22 ELISA Kit – Quantikine R&D Systems Cat#: D2200 Deposited data Raw single cell RNAseq data This paper GEO: GSE294959 Processed single cell RNAseq data This paper CELLxGENE: LNCS: Atlas of healthy human lymph nodes with and without ex vivo adjuvant stimulation Software and algorithms Original code for single cell RNAseq analysis This paper https://doi.org/10.5281/zenodo.15387998 (https://github.com/DendrouLab/ LymphNodeCultureSlice_2025CellRep) Original code for multiplex image quantification This paper https://doi.org/10.5281/zenodo.15396757 (https://github.com/edwardjenkins1/ 2D_spatial_analysis_lymph_node) QuPath v0.4.3 Bankhead, P. et al. QuPath: Open source software for digital pathology image analysis. .. Scientific Reports (2017). https://doi.org/10.1038/ s41598-017-17204-5 https://qupath.github.io/ FlowJo v10.8.1 BD Life Sciences https://docs.flowjo.com/flowjo/ getting-acquainted/10-8-release-notes/ 10-8-1-exhaustive-release-notes/ R: A language and environment for statistical https://www.R-project.org/ Version 4.3.2 18 Cell Reports 44, 115938, July 22, 2025 sufficient cell representation in transcriptomic analyses, resulting in seven donors for whole LN analyses and six for analysis of LN slices.
Formulation:Article Title: Ex vivo model of functioning human lymph node reveals role for innate lymphocytes and stroma in response to vaccine adjuvant.
Article Snippet: .. Human LN samples were collected over a 3-year period, with the aim of generating at least five donors per group to ensure REAGENT or RESOURCE SOURCE IDENTIFIER Biological samples Healthy human lymph nodes Cholecystectomy REC 21/YH/0206 Chemicals, peptides, and recombinant proteins LMQ Vaccine Formulation Initiative https://doi.org/10.3389/fimmu.2022.976968 1,1’ – Dioctadecyl-3,3,3′3′-Tetramethylindodicarbocyanine Perchlorate (DiD’/DiIC18(5)) oil ThermoFisher Scientific Cat#:D307 TLR4 inhibitor, TAK242 Merck Cat#: 614316 CP-456773 sodium salt (MCC950) Sigma Aldrich Cat#: PZ0280 Critical commercial assays LEGENDplex Human Inflammation Panel 1 BioLegend Cat#:740809 Human IL-22 ELISA Kit – Quantikine R&D Systems Cat#: D2200 Deposited data Raw single cell RNAseq data This paper GEO: GSE294959 Processed single cell RNAseq data This paper CELLxGENE: LNCS: Atlas of healthy human lymph nodes with and without ex vivo adjuvant stimulation Software and algorithms Original code for single cell RNAseq analysis This paper https://doi.org/10.5281/zenodo.15387998 (https://github.com/DendrouLab/ LymphNodeCultureSlice_2025CellRep) Original code for multiplex image quantification This paper https://doi.org/10.5281/zenodo.15396757 (https://github.com/edwardjenkins1/ 2D_spatial_analysis_lymph_node) QuPath v0.4.3 Bankhead, P. et al. QuPath: Open source software for digital pathology image analysis. .. Scientific Reports (2017). https://doi.org/10.1038/ s41598-017-17204-5 https://qupath.github.io/ FlowJo v10.8.1 BD Life Sciences https://docs.flowjo.com/flowjo/ getting-acquainted/10-8-release-notes/ 10-8-1-exhaustive-release-notes/ R: A language and environment for statistical https://www.R-project.org/ Version 4.3.2 18 Cell Reports 44, 115938, July 22, 2025 sufficient cell representation in transcriptomic analyses, resulting in seven donors for whole LN analyses and six for analysis of LN slices.
Article Title: Ex vivo model of functioning human lymph node reveals role for innate lymphocytes and stroma in response to vaccine adjuvant
Article Snippet: .. Table S1: Human LN donor demographics Donor Self-declared Ethnicity Age Sex 1 White British 20 Female 2 White British 61 Female 3 White Eastern European 45 Male 4 White British 59 Male 5 White British 49 Female 6 White Eastern European 40 Male 7 White British 64 Female 8 White British 54 Female 9 White British 54 Female 10 Asian 51 Female 11 White other 75 Female Table S6: General reagents used throughout study REAGENT SOURCE IDENTIFIER LMQ Vaccine Formulation Initiative DOI: 10.3389/fimmu.2022.976968 RPMI 1640 Medium ThermoFisher Scientific (Gibco) Cat#: 21875-034 Dispase II, powder ThermoFisher Scientific Cat#: 17105-041 Collagenase P Merck Cat#: 11213857001 Deoxyribonuclease I from bovine pancreas Sigma Aldrich Cat#: D5025-150KU PBS, pH 7.4 ThermoFisher Scientific (Gibco) Cat#: 10010015 Fetal Bovine Serum, Value, One ShotTM format ThermoFisher Scientific (Gibco) Cat#: A5209401 UltraPure 0.5M EDTA, pH 8.0 ThermoFisher Scientific (Invitrogen) Cat#: 15575020 1,1’ – Dioctadecyl-3,3,3’3’-Tetramethylindodicarbocyanine Perchlorate (DiD’/DiIC18(5)) oil ThermoFisher Scientific Cat#:D307 Digitonin (5%) ThermoFisher Scientific Cat#: BN2006 UltraPure Agarose ThermoFisher Scientific (Invitrogen) Cat#: 16500500 Penicillin-Streptomycin (10,000 U/ml) ThermoFisher Scientific (Gibco) Cat#: 15140122 2-Mercaptoethanol VWR Lifescience Cat#: 0482-100ML Sodium Pyruvate (100mM) ThermoFisher Scientific Cat#: 11360070 MEM Non-Essential Amino Acids Solution (100X) ThermoFisher Scientific Cat#: 11140035 HEPES (1M) ThermoFisher Scientific (Gibco) Cat#: 15630056 CP-456773 sodium salt (MCC950) Sigma Aldrich Cat#: PZ0280 TLR4 inhibitor, TAK242 Merck Cat#: 614316 LEGENDplex Human Inflammation Panel 1 BioLegend Cat#: 740809 Human IL-22 ELISA Kit - Quantikine R&D Systems Cat#: D2200 eBioscience Cell Stimulation Cocktail (500X) ThermoFisher Scientific (Invitrogen) Cat#: 00-4970-93 Table S7: Flow cytometry Antibodies, Instrument, Software REAGENT SOURCE Antibodies Clone Cat. No. .. Scientific Reports (2017). https://doi.org/10.1038/s415 98-017-17204-5 Cell DIVE multiplexed imaging platform General Electric https://www.ge.com/rese arch/project/multiplexedtissue-imaging-platform Epredia Gemini AS Automated Slide Stainer Fisher Scientific https://www.fishersci.co.u k/shop/products/geminias-automated-slidestainer/15243973 Manual Rotary Microtome HistoCore BIOCUT Leica https://www.leicabiosyste ms.com/en-gb/histologyequipment/microtomes/hi stocore-biocut/ Hardware Cat#: 92324 Cat#: 92234 https://qupath.github.io/ Cat#: T9284 Cat#: T6066 Cat#: 534056 Product code 10149870 Cat#: 3800145G Software Cat#: A7906 Cat#: H-3300 Cat#: D3571 Cat#: 437117K Cat#: 02370 Cat #: S6297 Cat#: 30620-1KG-M Cat#: 130-059-901 Cat#: G5516 Cat#: 216763 Cat#: 422302 Other Ca#: D9663 Cat#: 33312 Cat#: 32221-2.5L IDENTIFIER Table S9: qPCR primers and reagents Gene symbol Gene Forward primer Reverse primer Manufacturer 18S rRNA 18S ribosomal RNA GACAAATCGCTCCACCAACT CCTGGGGCTTAATTTGACTC IL1B Interleukin 1b TGATGGCTAACTACGGTGACAACA CTCAGAGAACCAAGGTCCAGGTTT IL6 Interleukin 6 CTCTCCACAAGCGCCTTTAGTC GCATTTTGTCTGAGGTGGCATC REAGENT SOURCE IDENTIFIER SYBR Green PCR Master Mix ThermoFisher Scientific Cat#: 4309155 First Strand cDNA Synthesis Kit ThermoFisher Scientific Cat#: K1612 RNeasy Mini Kit Qiagen Cat#: 74106 RNase-Free DNase Set Qiagen Cat#: 79254 Design & Analysis Software 2.6.0 AppliedBioSystems by ThermoFisher Scientific ViiA 7 Real-Time PCR System ThermoFisher Scientific ThermoFisher Scientific SOFTWARE HARDWARE METHODS S1: Methods relating to supplementary material only Pig Samples Porcine mesenteric lymph nodes from healthy piglets were kindly provided by The Pirbright Institute, and were processed as for human lymph nodes.
Article Title: Ex vivo model of functioning human lymph node reveals role for innate lymphocytes and stroma in response to vaccine adjuvant
Article Snippet: .. Table S1: Human LN donor demographics Donor Self-declared Ethnicity Age Sex 1 White British 20 Female 2 White British 61 Female 3 White Eastern European 45 Male 4 White British 59 Male 5 White British 49 Female 6 White Eastern European 40 Male 7 White British 64 Female 8 White British 54 Female 9 White British 54 Female 10 Asian 51 Female 11 White other 75 Female Table S6: General reagents used throughout study REAGENT SOURCE IDENTIFIER LMQ Vaccine Formulation Initiative DOI: 10.3389/fimmu.2022.976968 RPMI 1640 Medium ThermoFisher Scientific (Gibco) Cat#: 21875-034 Dispase II, powder ThermoFisher Scientific Cat#: 17105-041 Collagenase P Merck Cat#: 11213857001 Deoxyribonuclease I from bovine pancreas Sigma Aldrich Cat#: D5025-150KU PBS, pH 7.4 ThermoFisher Scientific (Gibco) Cat#: 10010015 Fetal Bovine Serum, Value, One ShotTM format ThermoFisher Scientific (Gibco) Cat#: A5209401 UltraPure 0.5M EDTA, pH 8.0 ThermoFisher Scientific (Invitrogen) Cat#: 15575020 1,1’ – Dioctadecyl-3,3,3’3’-Tetramethylindodicarbocyanine Perchlorate (DiD’/DiIC18(5)) oil ThermoFisher Scientific Cat#:D307 Digitonin (5%) ThermoFisher Scientific Cat#: BN2006 UltraPure Agarose ThermoFisher Scientific (Invitrogen) Cat#: 16500500 Penicillin-Streptomycin (10,000 U/ml) ThermoFisher Scientific (Gibco) Cat#: 15140122 2-Mercaptoethanol VWR Lifescience Cat#: 0482-100ML Sodium Pyruvate (100mM) ThermoFisher Scientific Cat#: 11360070 MEM Non-Essential Amino Acids Solution (100X) ThermoFisher Scientific Cat#: 11140035 HEPES (1M) ThermoFisher Scientific (Gibco) Cat#: 15630056 CP-456773 sodium salt (MCC950) Sigma Aldrich Cat#: PZ0280 TLR4 inhibitor, TAK242 Merck Cat#: 614316 LEGENDplex Human Inflammation Panel 1 BioLegend Cat#: 740809 Human IL-22 ELISA Kit - Quantikine R&D Systems Cat#: D2200 eBioscience Cell Stimulation Cocktail (500X) ThermoFisher Scientific (Invitrogen) Cat#: 00-4970-93 Table S7: Flow cytometry Antibodies, Instrument, Software REAGENT SOURCE Antibodies Clone Cat. No. .. Scientific Reports (2017). https://doi.org/10.1038/s415 98-017-17204-5 Cell DIVE multiplexed imaging platform General Electric https://www.ge.com/rese arch/project/multiplexedtissue-imaging-platform Epredia Gemini AS Automated Slide Stainer Fisher Scientific https://www.fishersci.co.u k/shop/products/geminias-automated-slidestainer/15243973 Manual Rotary Microtome HistoCore BIOCUT Leica https://www.leicabiosyste ms.com/en-gb/histologyequipment/microtomes/hi stocore-biocut/ Hardware Cat#: 92324 Cat#: 92234 https://qupath.github.io/ Cat#: T9284 Cat#: T6066 Cat#: 534056 Product code 10149870 Cat#: 3800145G Software Cat#: A7906 Cat#: H-3300 Cat#: D3571 Cat#: 437117K Cat#: 02370 Cat #: S6297 Cat#: 30620-1KG-M Cat#: 130-059-901 Cat#: G5516 Cat#: 216763 Cat#: 422302 Other Ca#: D9663 Cat#: 33312 Cat#: 32221-2.5L IDENTIFIER Table S9: qPCR primers and reagents Gene symbol Gene Forward primer Reverse primer Manufacturer 18S rRNA 18S ribosomal RNA GACAAATCGCTCCACCAACT CCTGGGGCTTAATTTGACTC IL1B Interleukin 1b TGATGGCTAACTACGGTGACAACA CTCAGAGAACCAAGGTCCAGGTTT IL6 Interleukin 6 CTCTCCACAAGCGCCTTTAGTC GCATTTTGTCTGAGGTGGCATC REAGENT SOURCE IDENTIFIER SYBR Green PCR Master Mix ThermoFisher Scientific Cat#: 4309155 First Strand cDNA Synthesis Kit ThermoFisher Scientific Cat#: K1612 RNeasy Mini Kit Qiagen Cat#: 74106 RNase-Free DNase Set Qiagen Cat#: 79254 Design & Analysis Software 2.6.0 AppliedBioSystems by ThermoFisher Scientific ViiA 7 Real-Time PCR System ThermoFisher Scientific ThermoFisher Scientific SOFTWARE HARDWARE METHODS S1: Methods relating to supplementary material only Pig Samples Porcine mesenteric lymph nodes from healthy piglets were kindly provided by The Pirbright Institute, and were processed as for human lymph nodes.
Enzyme-linked Immunosorbent Assay:Article Title: Ex vivo model of functioning human lymph node reveals role for innate lymphocytes and stroma in response to vaccine adjuvant.
Article Snippet: .. Human LN samples were collected over a 3-year period, with the aim of generating at least five donors per group to ensure REAGENT or RESOURCE SOURCE IDENTIFIER Biological samples Healthy human lymph nodes Cholecystectomy REC 21/YH/0206 Chemicals, peptides, and recombinant proteins LMQ Vaccine Formulation Initiative https://doi.org/10.3389/fimmu.2022.976968 1,1’ – Dioctadecyl-3,3,3′3′-Tetramethylindodicarbocyanine Perchlorate (DiD’/DiIC18(5)) oil ThermoFisher Scientific Cat#:D307 TLR4 inhibitor, TAK242 Merck Cat#: 614316 CP-456773 sodium salt (MCC950) Sigma Aldrich Cat#: PZ0280 Critical commercial assays LEGENDplex Human Inflammation Panel 1 BioLegend Cat#:740809 Human IL-22 ELISA Kit – Quantikine R&D Systems Cat#: D2200 Deposited data Raw single cell RNAseq data This paper GEO: GSE294959 Processed single cell RNAseq data This paper CELLxGENE: LNCS: Atlas of healthy human lymph nodes with and without ex vivo adjuvant stimulation Software and algorithms Original code for single cell RNAseq analysis This paper https://doi.org/10.5281/zenodo.15387998 (https://github.com/DendrouLab/ LymphNodeCultureSlice_2025CellRep) Original code for multiplex image quantification This paper https://doi.org/10.5281/zenodo.15396757 (https://github.com/edwardjenkins1/ 2D_spatial_analysis_lymph_node) QuPath v0.4.3 Bankhead, P. et al. QuPath: Open source software for digital pathology image analysis. .. Scientific Reports (2017). https://doi.org/10.1038/ s41598-017-17204-5 https://qupath.github.io/ FlowJo v10.8.1 BD Life Sciences https://docs.flowjo.com/flowjo/ getting-acquainted/10-8-release-notes/ 10-8-1-exhaustive-release-notes/ R: A language and environment for statistical https://www.R-project.org/ Version 4.3.2 18 Cell Reports 44, 115938, July 22, 2025 sufficient cell representation in transcriptomic analyses, resulting in seven donors for whole LN analyses and six for analysis of LN slices.
Article Title: Ex vivo model of functioning human lymph node reveals role for innate lymphocytes and stroma in response to vaccine adjuvant
Article Snippet: .. Table S1: Human LN donor demographics Donor Self-declared Ethnicity Age Sex 1 White British 20 Female 2 White British 61 Female 3 White Eastern European 45 Male 4 White British 59 Male 5 White British 49 Female 6 White Eastern European 40 Male 7 White British 64 Female 8 White British 54 Female 9 White British 54 Female 10 Asian 51 Female 11 White other 75 Female Table S6: General reagents used throughout study REAGENT SOURCE IDENTIFIER LMQ Vaccine Formulation Initiative DOI: 10.3389/fimmu.2022.976968 RPMI 1640 Medium ThermoFisher Scientific (Gibco) Cat#: 21875-034 Dispase II, powder ThermoFisher Scientific Cat#: 17105-041 Collagenase P Merck Cat#: 11213857001 Deoxyribonuclease I from bovine pancreas Sigma Aldrich Cat#: D5025-150KU PBS, pH 7.4 ThermoFisher Scientific (Gibco) Cat#: 10010015 Fetal Bovine Serum, Value, One ShotTM format ThermoFisher Scientific (Gibco) Cat#: A5209401 UltraPure 0.5M EDTA, pH 8.0 ThermoFisher Scientific (Invitrogen) Cat#: 15575020 1,1’ – Dioctadecyl-3,3,3’3’-Tetramethylindodicarbocyanine Perchlorate (DiD’/DiIC18(5)) oil ThermoFisher Scientific Cat#:D307 Digitonin (5%) ThermoFisher Scientific Cat#: BN2006 UltraPure Agarose ThermoFisher Scientific (Invitrogen) Cat#: 16500500 Penicillin-Streptomycin (10,000 U/ml) ThermoFisher Scientific (Gibco) Cat#: 15140122 2-Mercaptoethanol VWR Lifescience Cat#: 0482-100ML Sodium Pyruvate (100mM) ThermoFisher Scientific Cat#: 11360070 MEM Non-Essential Amino Acids Solution (100X) ThermoFisher Scientific Cat#: 11140035 HEPES (1M) ThermoFisher Scientific (Gibco) Cat#: 15630056 CP-456773 sodium salt (MCC950) Sigma Aldrich Cat#: PZ0280 TLR4 inhibitor, TAK242 Merck Cat#: 614316 LEGENDplex Human Inflammation Panel 1 BioLegend Cat#: 740809 Human IL-22 ELISA Kit - Quantikine R&D Systems Cat#: D2200 eBioscience Cell Stimulation Cocktail (500X) ThermoFisher Scientific (Invitrogen) Cat#: 00-4970-93 Table S7: Flow cytometry Antibodies, Instrument, Software REAGENT SOURCE Antibodies Clone Cat. No. .. Scientific Reports (2017). https://doi.org/10.1038/s415 98-017-17204-5 Cell DIVE multiplexed imaging platform General Electric https://www.ge.com/rese arch/project/multiplexedtissue-imaging-platform Epredia Gemini AS Automated Slide Stainer Fisher Scientific https://www.fishersci.co.u k/shop/products/geminias-automated-slidestainer/15243973 Manual Rotary Microtome HistoCore BIOCUT Leica https://www.leicabiosyste ms.com/en-gb/histologyequipment/microtomes/hi stocore-biocut/ Hardware Cat#: 92324 Cat#: 92234 https://qupath.github.io/ Cat#: T9284 Cat#: T6066 Cat#: 534056 Product code 10149870 Cat#: 3800145G Software Cat#: A7906 Cat#: H-3300 Cat#: D3571 Cat#: 437117K Cat#: 02370 Cat #: S6297 Cat#: 30620-1KG-M Cat#: 130-059-901 Cat#: G5516 Cat#: 216763 Cat#: 422302 Other Ca#: D9663 Cat#: 33312 Cat#: 32221-2.5L IDENTIFIER Table S9: qPCR primers and reagents Gene symbol Gene Forward primer Reverse primer Manufacturer 18S rRNA 18S ribosomal RNA GACAAATCGCTCCACCAACT CCTGGGGCTTAATTTGACTC IL1B Interleukin 1b TGATGGCTAACTACGGTGACAACA CTCAGAGAACCAAGGTCCAGGTTT IL6 Interleukin 6 CTCTCCACAAGCGCCTTTAGTC GCATTTTGTCTGAGGTGGCATC REAGENT SOURCE IDENTIFIER SYBR Green PCR Master Mix ThermoFisher Scientific Cat#: 4309155 First Strand cDNA Synthesis Kit ThermoFisher Scientific Cat#: K1612 RNeasy Mini Kit Qiagen Cat#: 74106 RNase-Free DNase Set Qiagen Cat#: 79254 Design & Analysis Software 2.6.0 AppliedBioSystems by ThermoFisher Scientific ViiA 7 Real-Time PCR System ThermoFisher Scientific ThermoFisher Scientific SOFTWARE HARDWARE METHODS S1: Methods relating to supplementary material only Pig Samples Porcine mesenteric lymph nodes from healthy piglets were kindly provided by The Pirbright Institute, and were processed as for human lymph nodes.
Article Title: Ex vivo model of functioning human lymph node reveals role for innate lymphocytes and stroma in response to vaccine adjuvant
Article Snippet: .. Table S1: Human LN donor demographics Donor Self-declared Ethnicity Age Sex 1 White British 20 Female 2 White British 61 Female 3 White Eastern European 45 Male 4 White British 59 Male 5 White British 49 Female 6 White Eastern European 40 Male 7 White British 64 Female 8 White British 54 Female 9 White British 54 Female 10 Asian 51 Female 11 White other 75 Female Table S6: General reagents used throughout study REAGENT SOURCE IDENTIFIER LMQ Vaccine Formulation Initiative DOI: 10.3389/fimmu.2022.976968 RPMI 1640 Medium ThermoFisher Scientific (Gibco) Cat#: 21875-034 Dispase II, powder ThermoFisher Scientific Cat#: 17105-041 Collagenase P Merck Cat#: 11213857001 Deoxyribonuclease I from bovine pancreas Sigma Aldrich Cat#: D5025-150KU PBS, pH 7.4 ThermoFisher Scientific (Gibco) Cat#: 10010015 Fetal Bovine Serum, Value, One ShotTM format ThermoFisher Scientific (Gibco) Cat#: A5209401 UltraPure 0.5M EDTA, pH 8.0 ThermoFisher Scientific (Invitrogen) Cat#: 15575020 1,1’ – Dioctadecyl-3,3,3’3’-Tetramethylindodicarbocyanine Perchlorate (DiD’/DiIC18(5)) oil ThermoFisher Scientific Cat#:D307 Digitonin (5%) ThermoFisher Scientific Cat#: BN2006 UltraPure Agarose ThermoFisher Scientific (Invitrogen) Cat#: 16500500 Penicillin-Streptomycin (10,000 U/ml) ThermoFisher Scientific (Gibco) Cat#: 15140122 2-Mercaptoethanol VWR Lifescience Cat#: 0482-100ML Sodium Pyruvate (100mM) ThermoFisher Scientific Cat#: 11360070 MEM Non-Essential Amino Acids Solution (100X) ThermoFisher Scientific Cat#: 11140035 HEPES (1M) ThermoFisher Scientific (Gibco) Cat#: 15630056 CP-456773 sodium salt (MCC950) Sigma Aldrich Cat#: PZ0280 TLR4 inhibitor, TAK242 Merck Cat#: 614316 LEGENDplex Human Inflammation Panel 1 BioLegend Cat#: 740809 Human IL-22 ELISA Kit - Quantikine R&D Systems Cat#: D2200 eBioscience Cell Stimulation Cocktail (500X) ThermoFisher Scientific (Invitrogen) Cat#: 00-4970-93 Table S7: Flow cytometry Antibodies, Instrument, Software REAGENT SOURCE Antibodies Clone Cat. No. .. Scientific Reports (2017). https://doi.org/10.1038/s415 98-017-17204-5 Cell DIVE multiplexed imaging platform General Electric https://www.ge.com/rese arch/project/multiplexedtissue-imaging-platform Epredia Gemini AS Automated Slide Stainer Fisher Scientific https://www.fishersci.co.u k/shop/products/geminias-automated-slidestainer/15243973 Manual Rotary Microtome HistoCore BIOCUT Leica https://www.leicabiosyste ms.com/en-gb/histologyequipment/microtomes/hi stocore-biocut/ Hardware Cat#: 92324 Cat#: 92234 https://qupath.github.io/ Cat#: T9284 Cat#: T6066 Cat#: 534056 Product code 10149870 Cat#: 3800145G Software Cat#: A7906 Cat#: H-3300 Cat#: D3571 Cat#: 437117K Cat#: 02370 Cat #: S6297 Cat#: 30620-1KG-M Cat#: 130-059-901 Cat#: G5516 Cat#: 216763 Cat#: 422302 Other Ca#: D9663 Cat#: 33312 Cat#: 32221-2.5L IDENTIFIER Table S9: qPCR primers and reagents Gene symbol Gene Forward primer Reverse primer Manufacturer 18S rRNA 18S ribosomal RNA GACAAATCGCTCCACCAACT CCTGGGGCTTAATTTGACTC IL1B Interleukin 1b TGATGGCTAACTACGGTGACAACA CTCAGAGAACCAAGGTCCAGGTTT IL6 Interleukin 6 CTCTCCACAAGCGCCTTTAGTC GCATTTTGTCTGAGGTGGCATC REAGENT SOURCE IDENTIFIER SYBR Green PCR Master Mix ThermoFisher Scientific Cat#: 4309155 First Strand cDNA Synthesis Kit ThermoFisher Scientific Cat#: K1612 RNeasy Mini Kit Qiagen Cat#: 74106 RNase-Free DNase Set Qiagen Cat#: 79254 Design & Analysis Software 2.6.0 AppliedBioSystems by ThermoFisher Scientific ViiA 7 Real-Time PCR System ThermoFisher Scientific ThermoFisher Scientific SOFTWARE HARDWARE METHODS S1: Methods relating to supplementary material only Pig Samples Porcine mesenteric lymph nodes from healthy piglets were kindly provided by The Pirbright Institute, and were processed as for human lymph nodes.
Single Cell:Article Title: Ex vivo model of functioning human lymph node reveals role for innate lymphocytes and stroma in response to vaccine adjuvant.
Article Snippet: .. Human LN samples were collected over a 3-year period, with the aim of generating at least five donors per group to ensure REAGENT or RESOURCE SOURCE IDENTIFIER Biological samples Healthy human lymph nodes Cholecystectomy REC 21/YH/0206 Chemicals, peptides, and recombinant proteins LMQ Vaccine Formulation Initiative https://doi.org/10.3389/fimmu.2022.976968 1,1’ – Dioctadecyl-3,3,3′3′-Tetramethylindodicarbocyanine Perchlorate (DiD’/DiIC18(5)) oil ThermoFisher Scientific Cat#:D307 TLR4 inhibitor, TAK242 Merck Cat#: 614316 CP-456773 sodium salt (MCC950) Sigma Aldrich Cat#: PZ0280 Critical commercial assays LEGENDplex Human Inflammation Panel 1 BioLegend Cat#:740809 Human IL-22 ELISA Kit – Quantikine R&D Systems Cat#: D2200 Deposited data Raw single cell RNAseq data This paper GEO: GSE294959 Processed single cell RNAseq data This paper CELLxGENE: LNCS: Atlas of healthy human lymph nodes with and without ex vivo adjuvant stimulation Software and algorithms Original code for single cell RNAseq analysis This paper https://doi.org/10.5281/zenodo.15387998 (https://github.com/DendrouLab/ LymphNodeCultureSlice_2025CellRep) Original code for multiplex image quantification This paper https://doi.org/10.5281/zenodo.15396757 (https://github.com/edwardjenkins1/ 2D_spatial_analysis_lymph_node) QuPath v0.4.3 Bankhead, P. et al. QuPath: Open source software for digital pathology image analysis. .. Scientific Reports (2017). https://doi.org/10.1038/ s41598-017-17204-5 https://qupath.github.io/ FlowJo v10.8.1 BD Life Sciences https://docs.flowjo.com/flowjo/ getting-acquainted/10-8-release-notes/ 10-8-1-exhaustive-release-notes/ R: A language and environment for statistical https://www.R-project.org/ Version 4.3.2 18 Cell Reports 44, 115938, July 22, 2025 sufficient cell representation in transcriptomic analyses, resulting in seven donors for whole LN analyses and six for analysis of LN slices.
RNA sequencing:Article Title: Ex vivo model of functioning human lymph node reveals role for innate lymphocytes and stroma in response to vaccine adjuvant.
Article Snippet: .. Human LN samples were collected over a 3-year period, with the aim of generating at least five donors per group to ensure REAGENT or RESOURCE SOURCE IDENTIFIER Biological samples Healthy human lymph nodes Cholecystectomy REC 21/YH/0206 Chemicals, peptides, and recombinant proteins LMQ Vaccine Formulation Initiative https://doi.org/10.3389/fimmu.2022.976968 1,1’ – Dioctadecyl-3,3,3′3′-Tetramethylindodicarbocyanine Perchlorate (DiD’/DiIC18(5)) oil ThermoFisher Scientific Cat#:D307 TLR4 inhibitor, TAK242 Merck Cat#: 614316 CP-456773 sodium salt (MCC950) Sigma Aldrich Cat#: PZ0280 Critical commercial assays LEGENDplex Human Inflammation Panel 1 BioLegend Cat#:740809 Human IL-22 ELISA Kit – Quantikine R&D Systems Cat#: D2200 Deposited data Raw single cell RNAseq data This paper GEO: GSE294959 Processed single cell RNAseq data This paper CELLxGENE: LNCS: Atlas of healthy human lymph nodes with and without ex vivo adjuvant stimulation Software and algorithms Original code for single cell RNAseq analysis This paper https://doi.org/10.5281/zenodo.15387998 (https://github.com/DendrouLab/ LymphNodeCultureSlice_2025CellRep) Original code for multiplex image quantification This paper https://doi.org/10.5281/zenodo.15396757 (https://github.com/edwardjenkins1/ 2D_spatial_analysis_lymph_node) QuPath v0.4.3 Bankhead, P. et al. QuPath: Open source software for digital pathology image analysis. .. Scientific Reports (2017). https://doi.org/10.1038/ s41598-017-17204-5 https://qupath.github.io/ FlowJo v10.8.1 BD Life Sciences https://docs.flowjo.com/flowjo/ getting-acquainted/10-8-release-notes/ 10-8-1-exhaustive-release-notes/ R: A language and environment for statistical https://www.R-project.org/ Version 4.3.2 18 Cell Reports 44, 115938, July 22, 2025 sufficient cell representation in transcriptomic analyses, resulting in seven donors for whole LN analyses and six for analysis of LN slices.
Ex Vivo:Article Title: Ex vivo model of functioning human lymph node reveals role for innate lymphocytes and stroma in response to vaccine adjuvant.
Article Snippet: .. Human LN samples were collected over a 3-year period, with the aim of generating at least five donors per group to ensure REAGENT or RESOURCE SOURCE IDENTIFIER Biological samples Healthy human lymph nodes Cholecystectomy REC 21/YH/0206 Chemicals, peptides, and recombinant proteins LMQ Vaccine Formulation Initiative https://doi.org/10.3389/fimmu.2022.976968 1,1’ – Dioctadecyl-3,3,3′3′-Tetramethylindodicarbocyanine Perchlorate (DiD’/DiIC18(5)) oil ThermoFisher Scientific Cat#:D307 TLR4 inhibitor, TAK242 Merck Cat#: 614316 CP-456773 sodium salt (MCC950) Sigma Aldrich Cat#: PZ0280 Critical commercial assays LEGENDplex Human Inflammation Panel 1 BioLegend Cat#:740809 Human IL-22 ELISA Kit – Quantikine R&D Systems Cat#: D2200 Deposited data Raw single cell RNAseq data This paper GEO: GSE294959 Processed single cell RNAseq data This paper CELLxGENE: LNCS: Atlas of healthy human lymph nodes with and without ex vivo adjuvant stimulation Software and algorithms Original code for single cell RNAseq analysis This paper https://doi.org/10.5281/zenodo.15387998 (https://github.com/DendrouLab/ LymphNodeCultureSlice_2025CellRep) Original code for multiplex image quantification This paper https://doi.org/10.5281/zenodo.15396757 (https://github.com/edwardjenkins1/ 2D_spatial_analysis_lymph_node) QuPath v0.4.3 Bankhead, P. et al. QuPath: Open source software for digital pathology image analysis. .. Scientific Reports (2017). https://doi.org/10.1038/ s41598-017-17204-5 https://qupath.github.io/ FlowJo v10.8.1 BD Life Sciences https://docs.flowjo.com/flowjo/ getting-acquainted/10-8-release-notes/ 10-8-1-exhaustive-release-notes/ R: A language and environment for statistical https://www.R-project.org/ Version 4.3.2 18 Cell Reports 44, 115938, July 22, 2025 sufficient cell representation in transcriptomic analyses, resulting in seven donors for whole LN analyses and six for analysis of LN slices.
Adjuvant:Article Title: Ex vivo model of functioning human lymph node reveals role for innate lymphocytes and stroma in response to vaccine adjuvant.
Article Snippet: .. Human LN samples were collected over a 3-year period, with the aim of generating at least five donors per group to ensure REAGENT or RESOURCE SOURCE IDENTIFIER Biological samples Healthy human lymph nodes Cholecystectomy REC 21/YH/0206 Chemicals, peptides, and recombinant proteins LMQ Vaccine Formulation Initiative https://doi.org/10.3389/fimmu.2022.976968 1,1’ – Dioctadecyl-3,3,3′3′-Tetramethylindodicarbocyanine Perchlorate (DiD’/DiIC18(5)) oil ThermoFisher Scientific Cat#:D307 TLR4 inhibitor, TAK242 Merck Cat#: 614316 CP-456773 sodium salt (MCC950) Sigma Aldrich Cat#: PZ0280 Critical commercial assays LEGENDplex Human Inflammation Panel 1 BioLegend Cat#:740809 Human IL-22 ELISA Kit – Quantikine R&D Systems Cat#: D2200 Deposited data Raw single cell RNAseq data This paper GEO: GSE294959 Processed single cell RNAseq data This paper CELLxGENE: LNCS: Atlas of healthy human lymph nodes with and without ex vivo adjuvant stimulation Software and algorithms Original code for single cell RNAseq analysis This paper https://doi.org/10.5281/zenodo.15387998 (https://github.com/DendrouLab/ LymphNodeCultureSlice_2025CellRep) Original code for multiplex image quantification This paper https://doi.org/10.5281/zenodo.15396757 (https://github.com/edwardjenkins1/ 2D_spatial_analysis_lymph_node) QuPath v0.4.3 Bankhead, P. et al. QuPath: Open source software for digital pathology image analysis. .. Scientific Reports (2017). https://doi.org/10.1038/ s41598-017-17204-5 https://qupath.github.io/ FlowJo v10.8.1 BD Life Sciences https://docs.flowjo.com/flowjo/ getting-acquainted/10-8-release-notes/ 10-8-1-exhaustive-release-notes/ R: A language and environment for statistical https://www.R-project.org/ Version 4.3.2 18 Cell Reports 44, 115938, July 22, 2025 sufficient cell representation in transcriptomic analyses, resulting in seven donors for whole LN analyses and six for analysis of LN slices.
Software:Article Title: Ex vivo model of functioning human lymph node reveals role for innate lymphocytes and stroma in response to vaccine adjuvant.
Article Snippet: .. Human LN samples were collected over a 3-year period, with the aim of generating at least five donors per group to ensure REAGENT or RESOURCE SOURCE IDENTIFIER Biological samples Healthy human lymph nodes Cholecystectomy REC 21/YH/0206 Chemicals, peptides, and recombinant proteins LMQ Vaccine Formulation Initiative https://doi.org/10.3389/fimmu.2022.976968 1,1’ – Dioctadecyl-3,3,3′3′-Tetramethylindodicarbocyanine Perchlorate (DiD’/DiIC18(5)) oil ThermoFisher Scientific Cat#:D307 TLR4 inhibitor, TAK242 Merck Cat#: 614316 CP-456773 sodium salt (MCC950) Sigma Aldrich Cat#: PZ0280 Critical commercial assays LEGENDplex Human Inflammation Panel 1 BioLegend Cat#:740809 Human IL-22 ELISA Kit – Quantikine R&D Systems Cat#: D2200 Deposited data Raw single cell RNAseq data This paper GEO: GSE294959 Processed single cell RNAseq data This paper CELLxGENE: LNCS: Atlas of healthy human lymph nodes with and without ex vivo adjuvant stimulation Software and algorithms Original code for single cell RNAseq analysis This paper https://doi.org/10.5281/zenodo.15387998 (https://github.com/DendrouLab/ LymphNodeCultureSlice_2025CellRep) Original code for multiplex image quantification This paper https://doi.org/10.5281/zenodo.15396757 (https://github.com/edwardjenkins1/ 2D_spatial_analysis_lymph_node) QuPath v0.4.3 Bankhead, P. et al. QuPath: Open source software for digital pathology image analysis. .. Scientific Reports (2017). https://doi.org/10.1038/ s41598-017-17204-5 https://qupath.github.io/ FlowJo v10.8.1 BD Life Sciences https://docs.flowjo.com/flowjo/ getting-acquainted/10-8-release-notes/ 10-8-1-exhaustive-release-notes/ R: A language and environment for statistical https://www.R-project.org/ Version 4.3.2 18 Cell Reports 44, 115938, July 22, 2025 sufficient cell representation in transcriptomic analyses, resulting in seven donors for whole LN analyses and six for analysis of LN slices.
Article Title: Ex vivo model of functioning human lymph node reveals role for innate lymphocytes and stroma in response to vaccine adjuvant
Article Snippet: .. Table S1: Human LN donor demographics Donor Self-declared Ethnicity Age Sex 1 White British 20 Female 2 White British 61 Female 3 White Eastern European 45 Male 4 White British 59 Male 5 White British 49 Female 6 White Eastern European 40 Male 7 White British 64 Female 8 White British 54 Female 9 White British 54 Female 10 Asian 51 Female 11 White other 75 Female Table S6: General reagents used throughout study REAGENT SOURCE IDENTIFIER LMQ Vaccine Formulation Initiative DOI: 10.3389/fimmu.2022.976968 RPMI 1640 Medium ThermoFisher Scientific (Gibco) Cat#: 21875-034 Dispase II, powder ThermoFisher Scientific Cat#: 17105-041 Collagenase P Merck Cat#: 11213857001 Deoxyribonuclease I from bovine pancreas Sigma Aldrich Cat#: D5025-150KU PBS, pH 7.4 ThermoFisher Scientific (Gibco) Cat#: 10010015 Fetal Bovine Serum, Value, One ShotTM format ThermoFisher Scientific (Gibco) Cat#: A5209401 UltraPure 0.5M EDTA, pH 8.0 ThermoFisher Scientific (Invitrogen) Cat#: 15575020 1,1’ – Dioctadecyl-3,3,3’3’-Tetramethylindodicarbocyanine Perchlorate (DiD’/DiIC18(5)) oil ThermoFisher Scientific Cat#:D307 Digitonin (5%) ThermoFisher Scientific Cat#: BN2006 UltraPure Agarose ThermoFisher Scientific (Invitrogen) Cat#: 16500500 Penicillin-Streptomycin (10,000 U/ml) ThermoFisher Scientific (Gibco) Cat#: 15140122 2-Mercaptoethanol VWR Lifescience Cat#: 0482-100ML Sodium Pyruvate (100mM) ThermoFisher Scientific Cat#: 11360070 MEM Non-Essential Amino Acids Solution (100X) ThermoFisher Scientific Cat#: 11140035 HEPES (1M) ThermoFisher Scientific (Gibco) Cat#: 15630056 CP-456773 sodium salt (MCC950) Sigma Aldrich Cat#: PZ0280 TLR4 inhibitor, TAK242 Merck Cat#: 614316 LEGENDplex Human Inflammation Panel 1 BioLegend Cat#: 740809 Human IL-22 ELISA Kit - Quantikine R&D Systems Cat#: D2200 eBioscience Cell Stimulation Cocktail (500X) ThermoFisher Scientific (Invitrogen) Cat#: 00-4970-93 Table S7: Flow cytometry Antibodies, Instrument, Software REAGENT SOURCE Antibodies Clone Cat. No. .. Scientific Reports (2017). https://doi.org/10.1038/s415 98-017-17204-5 Cell DIVE multiplexed imaging platform General Electric https://www.ge.com/rese arch/project/multiplexedtissue-imaging-platform Epredia Gemini AS Automated Slide Stainer Fisher Scientific https://www.fishersci.co.u k/shop/products/geminias-automated-slidestainer/15243973 Manual Rotary Microtome HistoCore BIOCUT Leica https://www.leicabiosyste ms.com/en-gb/histologyequipment/microtomes/hi stocore-biocut/ Hardware Cat#: 92324 Cat#: 92234 https://qupath.github.io/ Cat#: T9284 Cat#: T6066 Cat#: 534056 Product code 10149870 Cat#: 3800145G Software Cat#: A7906 Cat#: H-3300 Cat#: D3571 Cat#: 437117K Cat#: 02370 Cat #: S6297 Cat#: 30620-1KG-M Cat#: 130-059-901 Cat#: G5516 Cat#: 216763 Cat#: 422302 Other Ca#: D9663 Cat#: 33312 Cat#: 32221-2.5L IDENTIFIER Table S9: qPCR primers and reagents Gene symbol Gene Forward primer Reverse primer Manufacturer 18S rRNA 18S ribosomal RNA GACAAATCGCTCCACCAACT CCTGGGGCTTAATTTGACTC IL1B Interleukin 1b TGATGGCTAACTACGGTGACAACA CTCAGAGAACCAAGGTCCAGGTTT IL6 Interleukin 6 CTCTCCACAAGCGCCTTTAGTC GCATTTTGTCTGAGGTGGCATC REAGENT SOURCE IDENTIFIER SYBR Green PCR Master Mix ThermoFisher Scientific Cat#: 4309155 First Strand cDNA Synthesis Kit ThermoFisher Scientific Cat#: K1612 RNeasy Mini Kit Qiagen Cat#: 74106 RNase-Free DNase Set Qiagen Cat#: 79254 Design & Analysis Software 2.6.0 AppliedBioSystems by ThermoFisher Scientific ViiA 7 Real-Time PCR System ThermoFisher Scientific ThermoFisher Scientific SOFTWARE HARDWARE METHODS S1: Methods relating to supplementary material only Pig Samples Porcine mesenteric lymph nodes from healthy piglets were kindly provided by The Pirbright Institute, and were processed as for human lymph nodes.
Article Title: Ex vivo model of functioning human lymph node reveals role for innate lymphocytes and stroma in response to vaccine adjuvant
Article Snippet: .. Table S1: Human LN donor demographics Donor Self-declared Ethnicity Age Sex 1 White British 20 Female 2 White British 61 Female 3 White Eastern European 45 Male 4 White British 59 Male 5 White British 49 Female 6 White Eastern European 40 Male 7 White British 64 Female 8 White British 54 Female 9 White British 54 Female 10 Asian 51 Female 11 White other 75 Female Table S6: General reagents used throughout study REAGENT SOURCE IDENTIFIER LMQ Vaccine Formulation Initiative DOI: 10.3389/fimmu.2022.976968 RPMI 1640 Medium ThermoFisher Scientific (Gibco) Cat#: 21875-034 Dispase II, powder ThermoFisher Scientific Cat#: 17105-041 Collagenase P Merck Cat#: 11213857001 Deoxyribonuclease I from bovine pancreas Sigma Aldrich Cat#: D5025-150KU PBS, pH 7.4 ThermoFisher Scientific (Gibco) Cat#: 10010015 Fetal Bovine Serum, Value, One ShotTM format ThermoFisher Scientific (Gibco) Cat#: A5209401 UltraPure 0.5M EDTA, pH 8.0 ThermoFisher Scientific (Invitrogen) Cat#: 15575020 1,1’ – Dioctadecyl-3,3,3’3’-Tetramethylindodicarbocyanine Perchlorate (DiD’/DiIC18(5)) oil ThermoFisher Scientific Cat#:D307 Digitonin (5%) ThermoFisher Scientific Cat#: BN2006 UltraPure Agarose ThermoFisher Scientific (Invitrogen) Cat#: 16500500 Penicillin-Streptomycin (10,000 U/ml) ThermoFisher Scientific (Gibco) Cat#: 15140122 2-Mercaptoethanol VWR Lifescience Cat#: 0482-100ML Sodium Pyruvate (100mM) ThermoFisher Scientific Cat#: 11360070 MEM Non-Essential Amino Acids Solution (100X) ThermoFisher Scientific Cat#: 11140035 HEPES (1M) ThermoFisher Scientific (Gibco) Cat#: 15630056 CP-456773 sodium salt (MCC950) Sigma Aldrich Cat#: PZ0280 TLR4 inhibitor, TAK242 Merck Cat#: 614316 LEGENDplex Human Inflammation Panel 1 BioLegend Cat#: 740809 Human IL-22 ELISA Kit - Quantikine R&D Systems Cat#: D2200 eBioscience Cell Stimulation Cocktail (500X) ThermoFisher Scientific (Invitrogen) Cat#: 00-4970-93 Table S7: Flow cytometry Antibodies, Instrument, Software REAGENT SOURCE Antibodies Clone Cat. No. .. Scientific Reports (2017). https://doi.org/10.1038/s415 98-017-17204-5 Cell DIVE multiplexed imaging platform General Electric https://www.ge.com/rese arch/project/multiplexedtissue-imaging-platform Epredia Gemini AS Automated Slide Stainer Fisher Scientific https://www.fishersci.co.u k/shop/products/geminias-automated-slidestainer/15243973 Manual Rotary Microtome HistoCore BIOCUT Leica https://www.leicabiosyste ms.com/en-gb/histologyequipment/microtomes/hi stocore-biocut/ Hardware Cat#: 92324 Cat#: 92234 https://qupath.github.io/ Cat#: T9284 Cat#: T6066 Cat#: 534056 Product code 10149870 Cat#: 3800145G Software Cat#: A7906 Cat#: H-3300 Cat#: D3571 Cat#: 437117K Cat#: 02370 Cat #: S6297 Cat#: 30620-1KG-M Cat#: 130-059-901 Cat#: G5516 Cat#: 216763 Cat#: 422302 Other Ca#: D9663 Cat#: 33312 Cat#: 32221-2.5L IDENTIFIER Table S9: qPCR primers and reagents Gene symbol Gene Forward primer Reverse primer Manufacturer 18S rRNA 18S ribosomal RNA GACAAATCGCTCCACCAACT CCTGGGGCTTAATTTGACTC IL1B Interleukin 1b TGATGGCTAACTACGGTGACAACA CTCAGAGAACCAAGGTCCAGGTTT IL6 Interleukin 6 CTCTCCACAAGCGCCTTTAGTC GCATTTTGTCTGAGGTGGCATC REAGENT SOURCE IDENTIFIER SYBR Green PCR Master Mix ThermoFisher Scientific Cat#: 4309155 First Strand cDNA Synthesis Kit ThermoFisher Scientific Cat#: K1612 RNeasy Mini Kit Qiagen Cat#: 74106 RNase-Free DNase Set Qiagen Cat#: 79254 Design & Analysis Software 2.6.0 AppliedBioSystems by ThermoFisher Scientific ViiA 7 Real-Time PCR System ThermoFisher Scientific ThermoFisher Scientific SOFTWARE HARDWARE METHODS S1: Methods relating to supplementary material only Pig Samples Porcine mesenteric lymph nodes from healthy piglets were kindly provided by The Pirbright Institute, and were processed as for human lymph nodes.
Multiplex Assay:Article Title: Ex vivo model of functioning human lymph node reveals role for innate lymphocytes and stroma in response to vaccine adjuvant.
Article Snippet: .. Human LN samples were collected over a 3-year period, with the aim of generating at least five donors per group to ensure REAGENT or RESOURCE SOURCE IDENTIFIER Biological samples Healthy human lymph nodes Cholecystectomy REC 21/YH/0206 Chemicals, peptides, and recombinant proteins LMQ Vaccine Formulation Initiative https://doi.org/10.3389/fimmu.2022.976968 1,1’ – Dioctadecyl-3,3,3′3′-Tetramethylindodicarbocyanine Perchlorate (DiD’/DiIC18(5)) oil ThermoFisher Scientific Cat#:D307 TLR4 inhibitor, TAK242 Merck Cat#: 614316 CP-456773 sodium salt (MCC950) Sigma Aldrich Cat#: PZ0280 Critical commercial assays LEGENDplex Human Inflammation Panel 1 BioLegend Cat#:740809 Human IL-22 ELISA Kit – Quantikine R&D Systems Cat#: D2200 Deposited data Raw single cell RNAseq data This paper GEO: GSE294959 Processed single cell RNAseq data This paper CELLxGENE: LNCS: Atlas of healthy human lymph nodes with and without ex vivo adjuvant stimulation Software and algorithms Original code for single cell RNAseq analysis This paper https://doi.org/10.5281/zenodo.15387998 (https://github.com/DendrouLab/ LymphNodeCultureSlice_2025CellRep) Original code for multiplex image quantification This paper https://doi.org/10.5281/zenodo.15396757 (https://github.com/edwardjenkins1/ 2D_spatial_analysis_lymph_node) QuPath v0.4.3 Bankhead, P. et al. QuPath: Open source software for digital pathology image analysis. .. Scientific Reports (2017). https://doi.org/10.1038/ s41598-017-17204-5 https://qupath.github.io/ FlowJo v10.8.1 BD Life Sciences https://docs.flowjo.com/flowjo/ getting-acquainted/10-8-release-notes/ 10-8-1-exhaustive-release-notes/ R: A language and environment for statistical https://www.R-project.org/ Version 4.3.2 18 Cell Reports 44, 115938, July 22, 2025 sufficient cell representation in transcriptomic analyses, resulting in seven donors for whole LN analyses and six for analysis of LN slices.
Cell Stimulation:Article Title: Ex vivo model of functioning human lymph node reveals role for innate lymphocytes and stroma in response to vaccine adjuvant
Article Snippet: .. Table S1: Human LN donor demographics Donor Self-declared Ethnicity Age Sex 1 White British 20 Female 2 White British 61 Female 3 White Eastern European 45 Male 4 White British 59 Male 5 White British 49 Female 6 White Eastern European 40 Male 7 White British 64 Female 8 White British 54 Female 9 White British 54 Female 10 Asian 51 Female 11 White other 75 Female Table S6: General reagents used throughout study REAGENT SOURCE IDENTIFIER LMQ Vaccine Formulation Initiative DOI: 10.3389/fimmu.2022.976968 RPMI 1640 Medium ThermoFisher Scientific (Gibco) Cat#: 21875-034 Dispase II, powder ThermoFisher Scientific Cat#: 17105-041 Collagenase P Merck Cat#: 11213857001 Deoxyribonuclease I from bovine pancreas Sigma Aldrich Cat#: D5025-150KU PBS, pH 7.4 ThermoFisher Scientific (Gibco) Cat#: 10010015 Fetal Bovine Serum, Value, One ShotTM format ThermoFisher Scientific (Gibco) Cat#: A5209401 UltraPure 0.5M EDTA, pH 8.0 ThermoFisher Scientific (Invitrogen) Cat#: 15575020 1,1’ – Dioctadecyl-3,3,3’3’-Tetramethylindodicarbocyanine Perchlorate (DiD’/DiIC18(5)) oil ThermoFisher Scientific Cat#:D307 Digitonin (5%) ThermoFisher Scientific Cat#: BN2006 UltraPure Agarose ThermoFisher Scientific (Invitrogen) Cat#: 16500500 Penicillin-Streptomycin (10,000 U/ml) ThermoFisher Scientific (Gibco) Cat#: 15140122 2-Mercaptoethanol VWR Lifescience Cat#: 0482-100ML Sodium Pyruvate (100mM) ThermoFisher Scientific Cat#: 11360070 MEM Non-Essential Amino Acids Solution (100X) ThermoFisher Scientific Cat#: 11140035 HEPES (1M) ThermoFisher Scientific (Gibco) Cat#: 15630056 CP-456773 sodium salt (MCC950) Sigma Aldrich Cat#: PZ0280 TLR4 inhibitor, TAK242 Merck Cat#: 614316 LEGENDplex Human Inflammation Panel 1 BioLegend Cat#: 740809 Human IL-22 ELISA Kit - Quantikine R&D Systems Cat#: D2200 eBioscience Cell Stimulation Cocktail (500X) ThermoFisher Scientific (Invitrogen) Cat#: 00-4970-93 Table S7: Flow cytometry Antibodies, Instrument, Software REAGENT SOURCE Antibodies Clone Cat. No. .. Scientific Reports (2017). https://doi.org/10.1038/s415 98-017-17204-5 Cell DIVE multiplexed imaging platform General Electric https://www.ge.com/rese arch/project/multiplexedtissue-imaging-platform Epredia Gemini AS Automated Slide Stainer Fisher Scientific https://www.fishersci.co.u k/shop/products/geminias-automated-slidestainer/15243973 Manual Rotary Microtome HistoCore BIOCUT Leica https://www.leicabiosyste ms.com/en-gb/histologyequipment/microtomes/hi stocore-biocut/ Hardware Cat#: 92324 Cat#: 92234 https://qupath.github.io/ Cat#: T9284 Cat#: T6066 Cat#: 534056 Product code 10149870 Cat#: 3800145G Software Cat#: A7906 Cat#: H-3300 Cat#: D3571 Cat#: 437117K Cat#: 02370 Cat #: S6297 Cat#: 30620-1KG-M Cat#: 130-059-901 Cat#: G5516 Cat#: 216763 Cat#: 422302 Other Ca#: D9663 Cat#: 33312 Cat#: 32221-2.5L IDENTIFIER Table S9: qPCR primers and reagents Gene symbol Gene Forward primer Reverse primer Manufacturer 18S rRNA 18S ribosomal RNA GACAAATCGCTCCACCAACT CCTGGGGCTTAATTTGACTC IL1B Interleukin 1b TGATGGCTAACTACGGTGACAACA CTCAGAGAACCAAGGTCCAGGTTT IL6 Interleukin 6 CTCTCCACAAGCGCCTTTAGTC GCATTTTGTCTGAGGTGGCATC REAGENT SOURCE IDENTIFIER SYBR Green PCR Master Mix ThermoFisher Scientific Cat#: 4309155 First Strand cDNA Synthesis Kit ThermoFisher Scientific Cat#: K1612 RNeasy Mini Kit Qiagen Cat#: 74106 RNase-Free DNase Set Qiagen Cat#: 79254 Design & Analysis Software 2.6.0 AppliedBioSystems by ThermoFisher Scientific ViiA 7 Real-Time PCR System ThermoFisher Scientific ThermoFisher Scientific SOFTWARE HARDWARE METHODS S1: Methods relating to supplementary material only Pig Samples Porcine mesenteric lymph nodes from healthy piglets were kindly provided by The Pirbright Institute, and were processed as for human lymph nodes.
Article Title: Ex vivo model of functioning human lymph node reveals role for innate lymphocytes and stroma in response to vaccine adjuvant
Article Snippet: .. Table S1: Human LN donor demographics Donor Self-declared Ethnicity Age Sex 1 White British 20 Female 2 White British 61 Female 3 White Eastern European 45 Male 4 White British 59 Male 5 White British 49 Female 6 White Eastern European 40 Male 7 White British 64 Female 8 White British 54 Female 9 White British 54 Female 10 Asian 51 Female 11 White other 75 Female Table S6: General reagents used throughout study REAGENT SOURCE IDENTIFIER LMQ Vaccine Formulation Initiative DOI: 10.3389/fimmu.2022.976968 RPMI 1640 Medium ThermoFisher Scientific (Gibco) Cat#: 21875-034 Dispase II, powder ThermoFisher Scientific Cat#: 17105-041 Collagenase P Merck Cat#: 11213857001 Deoxyribonuclease I from bovine pancreas Sigma Aldrich Cat#: D5025-150KU PBS, pH 7.4 ThermoFisher Scientific (Gibco) Cat#: 10010015 Fetal Bovine Serum, Value, One ShotTM format ThermoFisher Scientific (Gibco) Cat#: A5209401 UltraPure 0.5M EDTA, pH 8.0 ThermoFisher Scientific (Invitrogen) Cat#: 15575020 1,1’ – Dioctadecyl-3,3,3’3’-Tetramethylindodicarbocyanine Perchlorate (DiD’/DiIC18(5)) oil ThermoFisher Scientific Cat#:D307 Digitonin (5%) ThermoFisher Scientific Cat#: BN2006 UltraPure Agarose ThermoFisher Scientific (Invitrogen) Cat#: 16500500 Penicillin-Streptomycin (10,000 U/ml) ThermoFisher Scientific (Gibco) Cat#: 15140122 2-Mercaptoethanol VWR Lifescience Cat#: 0482-100ML Sodium Pyruvate (100mM) ThermoFisher Scientific Cat#: 11360070 MEM Non-Essential Amino Acids Solution (100X) ThermoFisher Scientific Cat#: 11140035 HEPES (1M) ThermoFisher Scientific (Gibco) Cat#: 15630056 CP-456773 sodium salt (MCC950) Sigma Aldrich Cat#: PZ0280 TLR4 inhibitor, TAK242 Merck Cat#: 614316 LEGENDplex Human Inflammation Panel 1 BioLegend Cat#: 740809 Human IL-22 ELISA Kit - Quantikine R&D Systems Cat#: D2200 eBioscience Cell Stimulation Cocktail (500X) ThermoFisher Scientific (Invitrogen) Cat#: 00-4970-93 Table S7: Flow cytometry Antibodies, Instrument, Software REAGENT SOURCE Antibodies Clone Cat. No. .. Scientific Reports (2017). https://doi.org/10.1038/s415 98-017-17204-5 Cell DIVE multiplexed imaging platform General Electric https://www.ge.com/rese arch/project/multiplexedtissue-imaging-platform Epredia Gemini AS Automated Slide Stainer Fisher Scientific https://www.fishersci.co.u k/shop/products/geminias-automated-slidestainer/15243973 Manual Rotary Microtome HistoCore BIOCUT Leica https://www.leicabiosyste ms.com/en-gb/histologyequipment/microtomes/hi stocore-biocut/ Hardware Cat#: 92324 Cat#: 92234 https://qupath.github.io/ Cat#: T9284 Cat#: T6066 Cat#: 534056 Product code 10149870 Cat#: 3800145G Software Cat#: A7906 Cat#: H-3300 Cat#: D3571 Cat#: 437117K Cat#: 02370 Cat #: S6297 Cat#: 30620-1KG-M Cat#: 130-059-901 Cat#: G5516 Cat#: 216763 Cat#: 422302 Other Ca#: D9663 Cat#: 33312 Cat#: 32221-2.5L IDENTIFIER Table S9: qPCR primers and reagents Gene symbol Gene Forward primer Reverse primer Manufacturer 18S rRNA 18S ribosomal RNA GACAAATCGCTCCACCAACT CCTGGGGCTTAATTTGACTC IL1B Interleukin 1b TGATGGCTAACTACGGTGACAACA CTCAGAGAACCAAGGTCCAGGTTT IL6 Interleukin 6 CTCTCCACAAGCGCCTTTAGTC GCATTTTGTCTGAGGTGGCATC REAGENT SOURCE IDENTIFIER SYBR Green PCR Master Mix ThermoFisher Scientific Cat#: 4309155 First Strand cDNA Synthesis Kit ThermoFisher Scientific Cat#: K1612 RNeasy Mini Kit Qiagen Cat#: 74106 RNase-Free DNase Set Qiagen Cat#: 79254 Design & Analysis Software 2.6.0 AppliedBioSystems by ThermoFisher Scientific ViiA 7 Real-Time PCR System ThermoFisher Scientific ThermoFisher Scientific SOFTWARE HARDWARE METHODS S1: Methods relating to supplementary material only Pig Samples Porcine mesenteric lymph nodes from healthy piglets were kindly provided by The Pirbright Institute, and were processed as for human lymph nodes.
Flow Cytometry:Article Title: Ex vivo model of functioning human lymph node reveals role for innate lymphocytes and stroma in response to vaccine adjuvant
Article Snippet: .. Table S1: Human LN donor demographics Donor Self-declared Ethnicity Age Sex 1 White British 20 Female 2 White British 61 Female 3 White Eastern European 45 Male 4 White British 59 Male 5 White British 49 Female 6 White Eastern European 40 Male 7 White British 64 Female 8 White British 54 Female 9 White British 54 Female 10 Asian 51 Female 11 White other 75 Female Table S6: General reagents used throughout study REAGENT SOURCE IDENTIFIER LMQ Vaccine Formulation Initiative DOI: 10.3389/fimmu.2022.976968 RPMI 1640 Medium ThermoFisher Scientific (Gibco) Cat#: 21875-034 Dispase II, powder ThermoFisher Scientific Cat#: 17105-041 Collagenase P Merck Cat#: 11213857001 Deoxyribonuclease I from bovine pancreas Sigma Aldrich Cat#: D5025-150KU PBS, pH 7.4 ThermoFisher Scientific (Gibco) Cat#: 10010015 Fetal Bovine Serum, Value, One ShotTM format ThermoFisher Scientific (Gibco) Cat#: A5209401 UltraPure 0.5M EDTA, pH 8.0 ThermoFisher Scientific (Invitrogen) Cat#: 15575020 1,1’ – Dioctadecyl-3,3,3’3’-Tetramethylindodicarbocyanine Perchlorate (DiD’/DiIC18(5)) oil ThermoFisher Scientific Cat#:D307 Digitonin (5%) ThermoFisher Scientific Cat#: BN2006 UltraPure Agarose ThermoFisher Scientific (Invitrogen) Cat#: 16500500 Penicillin-Streptomycin (10,000 U/ml) ThermoFisher Scientific (Gibco) Cat#: 15140122 2-Mercaptoethanol VWR Lifescience Cat#: 0482-100ML Sodium Pyruvate (100mM) ThermoFisher Scientific Cat#: 11360070 MEM Non-Essential Amino Acids Solution (100X) ThermoFisher Scientific Cat#: 11140035 HEPES (1M) ThermoFisher Scientific (Gibco) Cat#: 15630056 CP-456773 sodium salt (MCC950) Sigma Aldrich Cat#: PZ0280 TLR4 inhibitor, TAK242 Merck Cat#: 614316 LEGENDplex Human Inflammation Panel 1 BioLegend Cat#: 740809 Human IL-22 ELISA Kit - Quantikine R&D Systems Cat#: D2200 eBioscience Cell Stimulation Cocktail (500X) ThermoFisher Scientific (Invitrogen) Cat#: 00-4970-93 Table S7: Flow cytometry Antibodies, Instrument, Software REAGENT SOURCE Antibodies Clone Cat. No. .. Scientific Reports (2017). https://doi.org/10.1038/s415 98-017-17204-5 Cell DIVE multiplexed imaging platform General Electric https://www.ge.com/rese arch/project/multiplexedtissue-imaging-platform Epredia Gemini AS Automated Slide Stainer Fisher Scientific https://www.fishersci.co.u k/shop/products/geminias-automated-slidestainer/15243973 Manual Rotary Microtome HistoCore BIOCUT Leica https://www.leicabiosyste ms.com/en-gb/histologyequipment/microtomes/hi stocore-biocut/ Hardware Cat#: 92324 Cat#: 92234 https://qupath.github.io/ Cat#: T9284 Cat#: T6066 Cat#: 534056 Product code 10149870 Cat#: 3800145G Software Cat#: A7906 Cat#: H-3300 Cat#: D3571 Cat#: 437117K Cat#: 02370 Cat #: S6297 Cat#: 30620-1KG-M Cat#: 130-059-901 Cat#: G5516 Cat#: 216763 Cat#: 422302 Other Ca#: D9663 Cat#: 33312 Cat#: 32221-2.5L IDENTIFIER Table S9: qPCR primers and reagents Gene symbol Gene Forward primer Reverse primer Manufacturer 18S rRNA 18S ribosomal RNA GACAAATCGCTCCACCAACT CCTGGGGCTTAATTTGACTC IL1B Interleukin 1b TGATGGCTAACTACGGTGACAACA CTCAGAGAACCAAGGTCCAGGTTT IL6 Interleukin 6 CTCTCCACAAGCGCCTTTAGTC GCATTTTGTCTGAGGTGGCATC REAGENT SOURCE IDENTIFIER SYBR Green PCR Master Mix ThermoFisher Scientific Cat#: 4309155 First Strand cDNA Synthesis Kit ThermoFisher Scientific Cat#: K1612 RNeasy Mini Kit Qiagen Cat#: 74106 RNase-Free DNase Set Qiagen Cat#: 79254 Design & Analysis Software 2.6.0 AppliedBioSystems by ThermoFisher Scientific ViiA 7 Real-Time PCR System ThermoFisher Scientific ThermoFisher Scientific SOFTWARE HARDWARE METHODS S1: Methods relating to supplementary material only Pig Samples Porcine mesenteric lymph nodes from healthy piglets were kindly provided by The Pirbright Institute, and were processed as for human lymph nodes.
Article Title: Ex vivo model of functioning human lymph node reveals role for innate lymphocytes and stroma in response to vaccine adjuvant
Article Snippet: .. Table S1: Human LN donor demographics Donor Self-declared Ethnicity Age Sex 1 White British 20 Female 2 White British 61 Female 3 White Eastern European 45 Male 4 White British 59 Male 5 White British 49 Female 6 White Eastern European 40 Male 7 White British 64 Female 8 White British 54 Female 9 White British 54 Female 10 Asian 51 Female 11 White other 75 Female Table S6: General reagents used throughout study REAGENT SOURCE IDENTIFIER LMQ Vaccine Formulation Initiative DOI: 10.3389/fimmu.2022.976968 RPMI 1640 Medium ThermoFisher Scientific (Gibco) Cat#: 21875-034 Dispase II, powder ThermoFisher Scientific Cat#: 17105-041 Collagenase P Merck Cat#: 11213857001 Deoxyribonuclease I from bovine pancreas Sigma Aldrich Cat#: D5025-150KU PBS, pH 7.4 ThermoFisher Scientific (Gibco) Cat#: 10010015 Fetal Bovine Serum, Value, One ShotTM format ThermoFisher Scientific (Gibco) Cat#: A5209401 UltraPure 0.5M EDTA, pH 8.0 ThermoFisher Scientific (Invitrogen) Cat#: 15575020 1,1’ – Dioctadecyl-3,3,3’3’-Tetramethylindodicarbocyanine Perchlorate (DiD’/DiIC18(5)) oil ThermoFisher Scientific Cat#:D307 Digitonin (5%) ThermoFisher Scientific Cat#: BN2006 UltraPure Agarose ThermoFisher Scientific (Invitrogen) Cat#: 16500500 Penicillin-Streptomycin (10,000 U/ml) ThermoFisher Scientific (Gibco) Cat#: 15140122 2-Mercaptoethanol VWR Lifescience Cat#: 0482-100ML Sodium Pyruvate (100mM) ThermoFisher Scientific Cat#: 11360070 MEM Non-Essential Amino Acids Solution (100X) ThermoFisher Scientific Cat#: 11140035 HEPES (1M) ThermoFisher Scientific (Gibco) Cat#: 15630056 CP-456773 sodium salt (MCC950) Sigma Aldrich Cat#: PZ0280 TLR4 inhibitor, TAK242 Merck Cat#: 614316 LEGENDplex Human Inflammation Panel 1 BioLegend Cat#: 740809 Human IL-22 ELISA Kit - Quantikine R&D Systems Cat#: D2200 eBioscience Cell Stimulation Cocktail (500X) ThermoFisher Scientific (Invitrogen) Cat#: 00-4970-93 Table S7: Flow cytometry Antibodies, Instrument, Software REAGENT SOURCE Antibodies Clone Cat. No. .. Scientific Reports (2017). https://doi.org/10.1038/s415 98-017-17204-5 Cell DIVE multiplexed imaging platform General Electric https://www.ge.com/rese arch/project/multiplexedtissue-imaging-platform Epredia Gemini AS Automated Slide Stainer Fisher Scientific https://www.fishersci.co.u k/shop/products/geminias-automated-slidestainer/15243973 Manual Rotary Microtome HistoCore BIOCUT Leica https://www.leicabiosyste ms.com/en-gb/histologyequipment/microtomes/hi stocore-biocut/ Hardware Cat#: 92324 Cat#: 92234 https://qupath.github.io/ Cat#: T9284 Cat#: T6066 Cat#: 534056 Product code 10149870 Cat#: 3800145G Software Cat#: A7906 Cat#: H-3300 Cat#: D3571 Cat#: 437117K Cat#: 02370 Cat #: S6297 Cat#: 30620-1KG-M Cat#: 130-059-901 Cat#: G5516 Cat#: 216763 Cat#: 422302 Other Ca#: D9663 Cat#: 33312 Cat#: 32221-2.5L IDENTIFIER Table S9: qPCR primers and reagents Gene symbol Gene Forward primer Reverse primer Manufacturer 18S rRNA 18S ribosomal RNA GACAAATCGCTCCACCAACT CCTGGGGCTTAATTTGACTC IL1B Interleukin 1b TGATGGCTAACTACGGTGACAACA CTCAGAGAACCAAGGTCCAGGTTT IL6 Interleukin 6 CTCTCCACAAGCGCCTTTAGTC GCATTTTGTCTGAGGTGGCATC REAGENT SOURCE IDENTIFIER SYBR Green PCR Master Mix ThermoFisher Scientific Cat#: 4309155 First Strand cDNA Synthesis Kit ThermoFisher Scientific Cat#: K1612 RNeasy Mini Kit Qiagen Cat#: 74106 RNase-Free DNase Set Qiagen Cat#: 79254 Design & Analysis Software 2.6.0 AppliedBioSystems by ThermoFisher Scientific ViiA 7 Real-Time PCR System ThermoFisher Scientific ThermoFisher Scientific SOFTWARE HARDWARE METHODS S1: Methods relating to supplementary material only Pig Samples Porcine mesenteric lymph nodes from healthy piglets were kindly provided by The Pirbright Institute, and were processed as for human lymph nodes.
|
R&D Systems is a verified supplier 
R&D Systems manufactures this product 